XLOC_037608 (gene) - C. hemisphaerica

Overview
NameXLOC_037608
Unique NameXLOC_037608
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at scaffold_331:10971..11330+

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_037608 ID=XLOC_037608|Name=XLOC_037608|organism=Clytia hemisphaerica|type=gene|length=360bp|location=Sequence derived from alignment at scaffold_331:10971..11330+ (Clytia hemisphaerica)
caagaggcactttcgattctggacttaaactttttcggcaaatttgactt agtttgagaaaaagtgtaacaacatgtaataacgagtaacaacgggtaac aacgagtaacaagaggtaCTTTCGAtactggacttaaactttttcggcaa attttagttaatttgagaaaaagtgtaacaacaggtaataacgagtaaca acgggtaacaacgggtaacaagagaCACTTTCGGTACTGGAATTTTTAGG CTCGAATGATAACGTTCTAAATGTAATTCATTTTCTGGTTTCATTTCTTG TTTTAGCTTTCTTTGGTAGAAATCGAAATAATTAGTCATAATTTCTAAAG GGGAGTAACA
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00059779TCONS_00059779Clytia hemisphaericatranscript
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_331supercontigscaffold_331:10971..11330 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.75 0.74 0.85 0 2.04 1.61 1.94 0 0.64 0.79 0 1.51 4.52 3.65 1.29 0.92 0.57 0.58 4.81 3.36 0 1.07 0 0.79 3.24 2.17 0 4.42 0 0